GATCGGAAGAGCGGTTCAGCAGGAATG
Posted 11:38 AM

I knew it was some kind of primer, adapter or barcode - but I wasn't sure which, whether to trim, or if the barcode came before or after.

BLAS*T searches turned up nothing, but Joel answered, within a second, "it's an adapter sequence". He said "I just Googled it".

Reminder to self... Google searching DNA sequences works (NOTE: Bing didn't).
[View/Post Comments] [Digg] [Del.icio.us] [Stumble]