GATCGGAAGAGCGGTTCAGCAGGAATG
Posted 11:38 AM

I knew it was some kind of primer, adapter or barcode - but I wasn't sure which, whether to trim, or if the barcode came before or after.

BLAS*T searches turned up nothing, but Joel answered, within a second, "it's an adapter sequence". He said "I just Googled it".

Reminder to self... Google searching DNA sequences works (NOTE: Bing didn't).
[View/Post Comments] [Digg] [Del.icio.us] [Stumble]

Approximate Line Count for Very Large Files
Posted 2:06 AM

When dealing with very large files, the unix tool "wc" can be extremely slow. The alternative, byte size, is often not what I want to look at, especially when trying to estimate the number of reads in a fastq file.

A good estimate (2 sig figs) is, 90% of the time, what I need.

alc is my "approximate" line count tool. It counts the number of lines in a file, just like wc, except it only "samples" the file in a series of segments. By seeking and reading 200K from a dozen places in the file, rather than reading the whole thing, I get a good representative sample, and an accurate-enough count.
[View/Post Comments] [Digg] [Del.icio.us] [Stumble]

A True Teflon Alternative
Posted 6:00 PM

We went looking for a nonstick solution that wasn't coated in Teflon or PFTE, or whatever people try to sell it as. Apparently it causes developmental disorders in laboratory animals (click for EPA advisory). I can only wonder what it does to human kids.

The first thing we found was Swiss Diamond... which is a complete scam. Glad to have avoided that before making an expensive mistake, I scoured reviews and sites and we found the Aeternum and Green Earth line of ceramic coated pans (like porcelain, it seems).

I bought the Aeternum and it works exactly as well as advertised. Nonstick, and not made with creepy chemicals. If it lasts or breaks, I'll report it here.
[View/Post Comments] [Digg] [Del.icio.us] [Stumble]